EST 1765772 is a singleton


Sequence

>1765772 (1 EST) Length=371 CAACAACAACAACAAAAAACAAACTGGGCTCCAACAATGCGAATGGCTTCTTTTCCTGGATGCTGCGGTTACCGATGCCG ATGGCGCGTGGTGGCGGCGGGGGTGACGGTGGCAGTGGTGCGGAAAATGAAACTGAAAAAGCGTCAATGGCGCCGGAGCT TCATGAACAACAACAACAACAACAAAGAAAAAGACAGGAACATCAGGGGCCGAAGCAGCTGCTCTCCACTGGGTCAGAAA CATTGCCTGATGTGGTGTCGCATGAGTGGCGGTGGGATGACTACACGTTTGCGGCCAGCGCAACAACTTTGTTTTTACTA CTGCTACTACGCCACCATGTGGCGTGATTGAGCAGGTGGAGGGGAAACATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657723244390AI026564TENU0776T. cruzi epimastigote normalized cDNA Library


Date: 10:7:25 on Fri 24 Nov 117.