EST 1765777 is a singleton


Sequence

>1765777 (1 EST) Length=457 GAGAGAGCCTGGGTAAACCCATAGAAGAACGCCCGCCACGCCTCCCGGTTCCGCTCCTGCGAGAAAGTGCAGACGGAATC GTTGCCAAAAGCTCGTTCGGTGCGCTTGGCCTCACAAACCCAGTTCTGCCAAATGATAACCGACTCAATTTTCCTGATGA GGGCGAGAATATGGGGGGCAAACAAAACCCCTTCCCCGATTGGGATTCGGCACTGTGCAAACCATATTCTTCTCGATGGC TCACATAGTGCGACGCAAGCACCTCATCGCGGGAACCCACATTGTATGTCTTATCCTCATAACGAACAGGGCGGAGACTA GTATAACGCGGGACAACTGCTCGAAGAGCATCCCTCATTACCTCATCGTCATCTGAGCCGTCAGCCGTATCCAAAACGGT ATTTAATATGGAACGCCCAACGCTGTACTGACGCCTCCCCTCACGTGCCACACGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765777: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657773244395AI026569TENU0781T. cruzi epimastigote normalized cDNA Library


Date: 2:18:9 on Wed 22 Nov 117.