EST 1765792 is a singleton


Sequence

>1765792 (1 EST) Length=331 GTGGCACAGGAAAACTCATACAAGAGGTGACGAATCCCGCCATTGCCTCGGATGCTGTTCCTTCTCCTCAAGCTGCGGTT CCAGCGACGTCGACAACAACAACTGCAGCAGCAGCAGCGGCGTCCAGTGCAGCTTCAAAAGAGGAAAGAATTGTCCCTTC CTTAGTGAAGTTGCAGGGTGAGGGAATTTACGATTGGTCACGGCATGCTAAGCCGGTGCTTAACCCCTACTTTCGGGAAA ATATTCCTGCCACTTATGCCGTAGAGGTCTGTATTCCGACGGTGACGTCAATTGCAGAGGTGGAGGTGCGAATTACCCCC CGGTCTATAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765792: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657923244410AI026584TENU0796T. cruzi epimastigote normalized cDNA Library


Date: 13:29:21 on Thu 23 Nov 117.