EST 1765801 is a singleton


Sequence

>1765801 (1 EST) Length=336 AAATAGTTCCAACATTTTCGTCTCTTTTTTTTTTTTTTTTTTTTCTTGTATTCTATCAACAAGATATATTTCTGCCGCTC CCTTTTCCTCCTGTCCTTTTTATTTTGTGATTTATACTTTGCCCTCAGACAGCCAACACCTTGATTTTGAAGTCCCATGG CATGTAAGACCTCATCCATCCCATGAGCTACCACAGCAGACAGTGCGACGGTTTAATCACTCGCCAGTCCCGGAAAACGC CTCGGCTAAGCAACGGATGTATCCATTTGTGGAGGCTAACCGTGGCGGGGAGCGCGTAGAAGACTCATTCGCAGAAGAAA AATCTTTTACGTAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1765801: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17658013244419AI026593TENU0805T. cruzi epimastigote normalized cDNA Library


Date: 15:19:0 on Thu 23 Nov 117.