EST 1765805 is a singleton


Sequence

>1765805 (1 EST) Length=170 ATTCGCCCGGGCTGCTCTGCGACGCACAACGCGGATAAAATCCTCCAGTTCCTCCAGAATCCGACCGCGATGTTGCCAAA ACAGCCATCAGGACGAAGATCTTTCGCTGCCTGCAGCACACCCCACATGGCGGCACCACATGCTCCCTCCGACGAGGAGC GCCTCTTCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1765805: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17658053244423AI026597TENU0809T. cruzi epimastigote normalized cDNA Library


Date: 17:8:45 on Wed 22 Nov 117.