EST 1765809 is a singleton


Sequence

>1765809 (1 EST) Length=280 GTTTCTTCTACTTTCATACACCCCTTTCTAAACGTCGACCGCATGAAGTTTCATTTGTTGCGATGATGGTAGATAAATAA GGAAGGGTGAGATGTCATGGAGACGCCCTTGCCTCATTCCTTTTTTGATGTTGGATGTTGTCGCTTTTTTTTTTTCTCCT AGGGAAGTGTGTGTGGGAGAGGGGGAGGGGGGGGGAAGCCGTCGGTTTCTTTTGGGTGTTTGTGTGTGTATATATATATA CATATGTGTGGGCACTGTTACTCGTTTGCTTTCATTCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1765809: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17658093244427AI026601TENU0813T. cruzi epimastigote normalized cDNA Library


Date: 15:2:2 on Wed 22 Nov 117.