EST 1777060 is a singleton


Sequence

>1777060 (1 EST) Length=113 ACGAGATGTCACCCGTTGAAGATCAACGCTATTTTTCTTTTTTTTTTTTTTTCCATATTCCNTTGGCAGCACATACATCT GGCGCCACAGTAAATAAATAATAATAATAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1777060: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17770603269233AI037809TENU0840T. cruzi epimastigote normalized cDNA Library


Date: 23:15:37 on Sun 19 Nov 117.