EST 1777067 is a singleton


Sequence

>1777067 (1 EST) Length=290 ACCGGCGGGCACGCATCCTCCCTTTCTCCATTCATTCTTTTTTTTTTTTTTTCCCTTCTTATTTTATTTCCAAGAGTATT ACGTGGTTTTTCTTTTTTTTTTTTTTTTTTTTCTGGCGTTGAATAATAAAAAATAAAAAATTATTTTCTCTTTTGATGTT CTCCTCACCCGCCCCGCAACTTCGCACGCTGCTGGTTGGAATGCACACATGCGGGAGTGTCGGGGGACGGGGCAAAGAGA CATCATCTTCGTCATCTCCGCTTAACTTCTCCCACCCCCCTTTTCTTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1777067: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17770673269240AI037816TENU0847T. cruzi epimastigote normalized cDNA Library


Date: 11:50:24 on Fri 24 Nov 117.