EST 1777074 is a singleton


Sequence

>1777074 (1 EST) Length=314 ATAATGGTAAATTAGAAAAGAGCAAACAGAAATGTTGTGCGGTTGGCCGCTCTCCCAGCTGCCTGCGGCACGGGCTGTCA ACGTCAACGAAGCTTGCTGAATCCAATGTTTGCCGCGTTCTCACGGAAGCACTGGCGGCATACGTTGAGCTCGTACTTCC GAATAACCGCCTTCTGGTTCGAGCAGATCACGCAGTGGCGAGAGCCCTTGCCCATGCCTATCCTCTGCCGAGAACGCCAT TGTTCGAGGTGGCCCATCGTTGTCTTGAGTGTATTGGGGAGTTAAGAGAGTAACTCTGGCACAATATAGTACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1777074: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17770743269247AI037823TENU0854T. cruzi epimastigote normalized cDNA Library


Date: 19:20:33 on Sun 19 Nov 117.