EST 1777082 is a singleton


Sequence

>1777082 (1 EST) Length=208 ATTATTTTGTTGTTGTTTCTTTGTATTCATTTTTTTTTTTTTGCGTAAAAAAAAAAAAAGAGTAATTGCGCTGTTGCGAC TCTATTCCTGGTGTGTGGGGGGAAACGCGGGGAGCAGACGCTTTCCTAACCCGTGTTTTTACCACCGGAGAGAGCGATTT TTTGCAAGAGACCGGGATGTCTTCTCAAGCGGCCAATGTTTTCTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1777082: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17770823269255AI037831TENU0862T. cruzi epimastigote normalized cDNA Library


Date: 21:2:39 on Thu 18 Jan 118.