EST 1777089 is a singleton


Sequence

>1777089 (1 EST) Length=347 GTGGGGAGTGTGTCAGAGGATGAGCATCTTTCTAAGTGGGTCGATATTTTTGTCCCAAATAAGACGCAGGTGTTGGCAGG AGAAGATGATTCTAAAAGTGGAGTTGGGGTTTCGTTTGTCTCACCCTCTCTTGTCAGTGCTGGTGGTGTAATGGCTGTGC TTGCGGAGGGTATCATTTCATATAATCCCTCCGGTGCCACAGAAACTTTTGTTTATCATTCCGATATTGTTGCGGGGTAC GTCAACGCTGCGGAGTCGTGGCCGTCTCTTGTCGCCGAGATCAATGACGGTACATGGAGGGCACACACCGTGTTAAGTAC AGTGAATGAGGAGAGACATGTGGGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1777089: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17770893269262AI037838TENU0869T. cruzi epimastigote normalized cDNA Library


Date: 18:28:52 on Sat 18 Nov 117.