EST 1777093 is a singleton


Sequence

>1777093 (1 EST) Length=306 AGAAAAACAAATACGACGCCTAAACTTCCCACCACATCATTCCACAGACGCCAAAAAAGCGAAGACGACGCTCGGATGCG CCTGTACTGTCTGTAAAAACCACACTCGCCGTTGAAAAAAAAACGCGGTCTTTAAACTCCAAACGCACAGGCAGGACGAC AGTTGCAGCCTCAGCCGAGCCTTTTGCCTCATACGACTTTGATGCTCCCATGAGCTCCTGCAGCTGTTGGCTCAAAAGAT GCATCGGTGGATGCTCCCGCCGTGACGCCAACTCAGCCGCCCGCTGCGCCGCGTCAATGGAACGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1777093: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17770933269266AI037842TENU0873T. cruzi epimastigote normalized cDNA Library


Date: 23:53:13 on Fri 17 Nov 117.