EST 1777100 is a singleton


Sequence

>1777100 (1 EST) Length=228 AAATAAATGTAATAAAAATTGATAAGAATATATATGTATAGGGGGAGAAAAAAGCGAATCATATTCTTTCCTAAAATTTT TTGCTATTCCTCCTCGAAGGTTTAACAAGTAAGAACTTAAAAAATATTTCCTTGGGTATTTTAATTACGATTTTACTCAG AGTCGTCCTCGGCTTTTCGAGGGCGCTTTGTGGATTTTCTGGGGGCCTCACCGTACTGAACACCCTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1777100: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17771003269273AI037799TENU0880T. cruzi epimastigote normalized cDNA Library


Date: 16:29:47 on Sun 19 Nov 117.