EST 1782583 is a singleton


Sequence

>1782583 (1 EST) Length=436 GTTAGCTGCCGTAAAGAAGTTGTGTGCGTGCGTGCATGCGGTAAGGCGATGATCGTTAGTAAAATTAAAAAAAAAAATAT TACGAAAAACATGCGATTCAAAACGCGTGGCCGCACGGCTTCCTCTCCCCTCACGGAGTTTCCTCCCCCTCCCCCCAGAC GTTCCATGAACCCGTTGGCCGCAGCCGTAACGGAAGGGAACAGAGCGGGGTGACGTCACACATTGCACGCACAACAAAAT AAACAAACAAACAAACGATGTGTGACGCAAGACGCATTTGTAAACTTTCTCTTAGTTATAAATAGACACCTTACTCTCTT GCGTCCCTCCCTGACTCATATCCAGTTACGATGGAGCCTCTCCGGCCCTCCTCCTTTTTACGCTGTGGAGGCGATGTACT CCGTCGTTGTGGCTGCTTTAACTCGTTTGAGCTGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782583: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17825833286505AI043248TENU0887T. cruzi epimastigote normalized cDNA Library


Date: 4:26:5 on Wed 22 Nov 117.