EST 1782588 is a singleton


Sequence

>1782588 (1 EST) Length=227 CTTCCCCTTCTTCACAGTCACCTCGGGGGTCTCCGCAGCCCAAAGTACGCCTGCATTTTTATTCAATGATAAAACTCACC CACACAAAACGTTAATTATCATCCGCTATGATTTTTGTCCGCGTTTCCTGTCGTTTATGTTCCGGGCCGTTGTTGAGCGC TCCCTCTCCTCACCGCACCCTCCACCAGAAGGACAGGAACGCACACAAGTACACACACAAACACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782588: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17825883286510AI043253TENU0893T. cruzi epimastigote normalized cDNA Library


Date: 7:32:39 on Sat 18 Nov 117.