EST 1782589 is a singleton


Sequence

>1782589 (1 EST) Length=334 GGGCATGCAGCACTCGTTGAATCTCCCCATTCTTGCTATTCAGCAACTGGCGCAGGCCACTCAAATGTCGCTGCTGTTCG TCAAGGAGCGCCTCCCACCGGTGTCGCTCCTCGCGATGCCGCGCGCGTTCCGCCAGTAGCTGCGCTCGAGTGAGAGTCTC CTCCTCATCCTCGTCATCTTCCTTCTTGTGGCGGTTGCCATCTTCTTCTTTTCCCAGTGCCGCAGCCGCTTCATCGCGGA GACGTTTAATTCCCCCAACAGCTGACACGGCAGCCGCTGCTTTGCCACTTCGTTCTTCCACCACTGCGGTGACATACTTA CGAATGTCATGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1782589: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17825893286511AI043254TENU0894T. cruzi epimastigote normalized cDNA Library


Date: 10:48:56 on Tue 21 Nov 117.