EST 1782592 is a singleton


Sequence

>1782592 (1 EST) Length=293 CCATACCATAAAAAAGAAACAGAACAGGACTGCGCGTAAATTCATAAATCCATCAGAGGCTGCGGCGACAGGGAATGACA TCGACGTGGTCCTAACAACTTTTCACCCACTCGTCTCCACACCAAAAAAAAAGAGCTGAAAAAAAAAACTCATTCATTCT TTTTTTTGTTCCTTTTCGCCTCGTGCCCTACATGATTTCTTCACCCAGTCGATATGCATCAAAAGAAAAAAGCTCCTACA TTTTTATTATTATTATNATTTACATGCATTTATTCATCGCTTCTTTTGTTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782592: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17825923286514AI043257TENU0897T. cruzi epimastigote normalized cDNA Library


Date: 12:33:2 on Sun 19 Nov 117.