EST 1782596 is a singleton


Sequence

>1782596 (1 EST) Length=247 GCCTTCGAACTGCCGTCATAAATAATCGTGTCGATCGTCGTTCCAACCCATCGCAACCGCACCCCCGCGGCAAACACACA GAGAGATAGAGAAAGAAAGAAAAAAGAAAGCAGCCGAGGGGCTGTGGGGTGGAAGGCACCAAAAAAAAAAAAAAGGGACA CTGAGGCTACTACTCCCCAGCAACAAAAAAGTGCCACCGGACGATCACACGCAACAATATGACGTGGCAGAAGAAAATAA ATAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782596: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17825963286518AI043261TENU0901T. cruzi epimastigote normalized cDNA Library


Date: 2:44:11 on Thu 23 Nov 117.