EST 1782600 is a singleton


Sequence

>1782600 (1 EST) Length=275 AAATACACATGTGGATATGTACAGAAATGTACAAATGGTCCTCCCGCCAAAATTTGATAAGAAAATCGGGTAAAGGCAGA GAGAAGGCAATTGGCAAAAGTGTAGAAAAACATATATTATTATTATTATTATTTATCTCTTCTATTTTTGTTTTAATTTT TTCCGTCGCTGCCTCATTACAAGGTCCAGTTAAACCTTTCCAGTGGCAAGTTATGGCATGCAGAGCCTTGAGAACTTCCC CCTGAGAGGCGGTTGTCTCGAGGAGATTGAGAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1782600: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826003286522AI043265TENU0905T. cruzi epimastigote normalized cDNA Library


Date: 16:11:1 on Fri 17 Nov 117.