EST 1782601 is a singleton


Sequence

>1782601 (1 EST) Length=319 CAGAAATTAAAGTAAGAATAAATAAAAACTGGGTTAATAGTCCGGCAGTAACACCGGGAAGGATGAAGAAAATAGATTAG GTCGCAATTTTATTTCATGTGCCATGCAACACAATATAGACGATCGTGTTTTTGTGTATAAATCTTCCCCACAAAAATAG CAGAAAATAATATGATAAAAAAAGAAAAGATCTTGCTGCTCCACCAGCCCACACAAAATCCCTTATAATTCATCCGGCAT CCGGCGTGTTCCTTCAGTCCTCGTACGAGCAGTCCGTGGCACGCACAGCAGTGAGGCCGACACAGCGACTGGACAGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1782601: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826013286523AI043266TENU0906T. cruzi epimastigote normalized cDNA Library


Date: 23:38:16 on Sat 18 Nov 117.