EST 1782606 is a singleton


Sequence

>1782606 (1 EST) Length=311 CTTAAATTTATTTTTGTTTGAAATCTCTTCTCATTTCTTCTTCAAAAAACTCATCTCGTCCTCATCGTCATCATCCATGT TGTTGTCACTCAACGATGAAACCTCGGGATCGTTTGCTGCCATTTTGCCCTCATTACGCAGAGCCATCATTTCATCTTCC TCCTCATCCTCATCCTCCTCTGGCACGACGGCCGTGCCGCAGAAGGGCGGCTGCCATGGTCGACGTCGCCTCCGTCTCCG TGGGAATCACCTCAACCTCCTCACCATCCGCGATAATGTCCCACATGGACCAATACTTTCCATGCGCTACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1782606: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826063286528AI043271TENU0911T. cruzi epimastigote normalized cDNA Library


Date: 13:46:19 on Mon 20 Nov 117.