EST 1782613 is a singleton


Sequence

>1782613 (1 EST) Length=208 CATTCCTTCTCAAAAACAACAAAACCAGTAAACAACTCACTCGTACACGCACAAAAATGGAGCAGAAAACAAAAAAAAAA AAGTAAATAACAGAAATTATGGACCATAAGTTCCGTTGATCCATAAATCCATTGCATCCCTCAAACAGCTGCCAAACTGT TAATCTAATAATTGCCATGCTCCTTCCGGATTCATATATCCATTCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782613: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826133286535AI043278TENU0918T. cruzi epimastigote normalized cDNA Library


Date: 8:29:41 on Wed 22 Nov 117.