EST 1782614 is a singleton


Sequence

>1782614 (1 EST) Length=264 CCTAAAATAGAAATAAGTTATAAATTTTCTAAAGCCCCTTTTTAAAAAACTTGCACGCCCATTAAAGAACTAAAAAAAAG AGGCATTCCATCGTGAAGCGGGAAAAAAAAAAAATGTTTGTAAATTATTCATGCAGAAGTAAAAACACATTGGCTTCGAC CGTTCAGCCCTATTTTGTCCACACAACACCCAAATCTCATTGGGGCGCTCAGTGCGTTTTTTTTGTTTGTTTGTTTGCAT CCCAACTCCTTGTTTTTTTCCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782614: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826143286536AI043279TENU0919T. cruzi epimastigote normalized cDNA Library


Date: 1:46:37 on Sat 18 Nov 117.