EST 1782616 is a singleton


Sequence

>1782616 (1 EST) Length=280 GCAGCGTAGGAAAAGCAGAATACGATCTCATCAATAGTAAATAGGGTAAAAAAGCATTAAAAATAATCGCACAAAAAAAA AACTGGTCAATGTTGAAAAAACGAAATAAAAAAGAAAAAAAAAAAAAAAACCGGGATGCCTCCAAAGAAGCTACAACTTT ATGGGCACGGAAAACTCCATGGTGTCACCAGGGAAGCAGCCTATCCTCGGAGGCTCTGTACCAACCGTCTCAACACCAGT GCCAATGCGCATCGACGTGCCTCCAATACGTTCCGGTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782616: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826163286538AI043281TENU0921T. cruzi epimastigote normalized cDNA Library


Date: 1:9:5 on Tue 21 Nov 117.