EST 1782618 is a singleton


Sequence

>1782618 (1 EST) Length=156 ACTTGTGCGTGCGTCGTCTTTTTTACTCCCCACCTAACCCCAACCCTAACATACTCACACTCACTACCTGCCGTAAGCAC GGCTAATTGCACGCATGTATACAACGAAGTCTACCATCCGTTTTCCTTCAAAAATTTCTTTGAGTTCAAAAGAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782618: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826183286540AI043283TENU0923T. cruzi epimastigote normalized cDNA Library


Date: 10:38:35 on Mon 20 Nov 117.