EST 1782627 is a singleton


Sequence

>1782627 (1 EST) Length=285 CACAAATTATGCTGGTGTGCACTGCAAGGGCCTTTTTTGCGTTTGATTAAACGAGCACGAACCATCGGCGCGGCACGACT CAGCAGAAGGATCCCTCCTCCAGGCAACAGGCGCATGCATGTGTGCCCATACGCCCGGCCCCTTTACAGGAGCCGGCGCT TCTTCGCCGTGTTCATATACGGCTGCAGCACCCACTCCGTCCTCGGCGTCGTCCATCTCAAAGCGTCCCCAGTGTGATGC GGTACGGCGCCAGCTCCATGCGGGGGCCAACCTCCGTCAGCTGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1782627: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826273286549AI043292TENU0932T. cruzi epimastigote normalized cDNA Library


Date: 10:44:47 on Mon 20 Nov 117.