EST 1782632 is a singleton


Sequence

>1782632 (1 EST) Length=239 CTTTGCTAGAGGAGAAACAACAACGAAGAATCAAAGGAATATTATTTACTCAGGGAAAGAAAAACACAAATCAAGGATTT CAGTTTCCCAAAAAGCGCAGATTTGCAAGAGTCACAGATGTTAAAGTAAATAAAATTCAGTTTAACTTACACACATCACA GCGGGTATCTTCAGTAATCAGTATGCATGCTATTCTTAATTTCTTTATAGACCCTTATGAATGTAATAGGCCCCGCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826323286554AI043297TENU0937T. cruzi epimastigote normalized cDNA Library


Date: 8:49:52 on Fri 24 Nov 117.