EST 1782634 is a singleton


Sequence

>1782634 (1 EST) Length=257 AAGGATTGAAATAAAAATTTCCGACCTGCCTCACCGCCATAACAACAACCGCCTGCGGGCTACATGTGGCAAACGGTCAG AGGGCACCAAAGGAGAAATGCGTATTGAGAGTGTCTCCGAATAAAAACAACAACAACAAACAGACAAAAATAAAAAAAAC AGAGACGCTTCCAAACTAAAATGCGCATGGAAATATACGATTTATCAGCTCTTTTGGTGCAAATGTAATGGAAAAAAAAG GGGGGGAGGGAAAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782634: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826343286556AI043299TENU0939T. cruzi epimastigote normalized cDNA Library


Date: 17:17:46 on Wed 22 Nov 117.