EST 1782635 is a singleton


Sequence

>1782635 (1 EST) Length=165 CGCCACTTAAAAAGCATGAGCGTGTTTACCTCATGCACCCATCTCAAATAATAAAAATTAAAGAAATAAATGCAGCGCCA AAAAATAACAATAATAACAACAAAAAGCTGGCAAACTGCGCGGAACAAATCGGTAAAAAAAAAAAATGTGGGTAAGAAGA AACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1782635: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826353286557AI043300TENU0940T. cruzi epimastigote normalized cDNA Library


Date: 7:2:27 on Tue 21 Nov 117.