EST 1782636 is a singleton


Sequence

>1782636 (1 EST) Length=238 ACCAAACAGCCAAACAAACATTTCACTACTAATAACAACAACCGTAAAAATAATAATAATAATAATAATAATTCATTTTT CCCCAGTTTTCATGCCAAATCCTACACCCTCTCCTTTCTTCTTATCGCTCCACATCTTTTCCAGCCTGACATGCAACACG ATGCTCCGAATTACTACACATTCCCCACGGCAAAGGAGCAAATAAGACAAAAACATCAGCATGCACGGACACAATAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1782636: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826363286558AI043301TENU0941T. cruzi epimastigote normalized cDNA Library


Date: 5:9:1 on Tue 21 Nov 117.