EST 1782646 is a singleton


Sequence

>1782646 (1 EST) Length=281 GTTTCCCTCTTATTCCACGAGTAGATTTTACTGCATCCACGTACAATCCTGCACAGACAAATCTTAGAAACATTTCAAAC ACCTTCCACACCACCAGCCGCAGTCTGACCAATAAAAAAAATTACAACAAGAAGTATGTATATATATATATGTATGGTAA TAACAACAAATTCAGGATGGGGAAAAAGAAAAAATGTAAAATATTAATACTGTTGTAGCAAAATGTATTTGCTATTTTTG TTTTACGCAGCAGGTGGTGACAACAACCGAGCTGCACGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782646: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826463286568AI043311TENU0952T. cruzi epimastigote normalized cDNA Library


Date: 22:1:33 on Sat 18 Nov 117.