EST 1782653 is a singleton


Sequence

>1782653 (1 EST) Length=324 AACTAAAAGCAAGAAAAAAATACAAGTATAAAGAAAAAGAGGCAAAGAATTCAGGCCACAATGGTGCTTAATGGCAAATC CGCTGCGTTTCACAAAAACTCTCCAGGCGTTTCCAACATCACCCCTCTATTTGTCCTCTATCTCTCTCTTTTCCTTGATT CTCGTTCTTAGTGCGTGGCTCTCTTTGGAACCACTCCAGAGTGTGCAAGCGGACTGCAGCGGCAAGTGACTGCGCATCCG CCTCAGCGTTCAAAAAAAACTATTTTCACGACACTTCGAAATCCGTCCTGTAACCATGGCATTTGCACAATAGTAGTAAA ACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782653: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826533286575AI043318TENU0959T. cruzi epimastigote normalized cDNA Library


Date: 5:54:14 on Sun 19 Nov 117.