EST 1782663 is a singleton


Sequence

>1782663 (1 EST) Length=351 CGTTTACGTGATTGTACGGGCAATGCCGACATCTGTTTCCACAACAGATGCCACGCTTTATGTGGAAGTGTCGTGTCAGC ACTATCTGGCCGGTGTTCGGGTCGACGTACTTGTCCTTCCCCGCATCATGTGCCTTTTGGTGCATCTCCTCGACTTCGCG CGGGAGGCTTCTCTCCAACTCGTTTTTCTCCTCAACCACCACATTTTCCGGGGAACGAATAGCTGCCAGCCTCCGCAGAC GCTCCTGAAGGATCGTGGAGGTAAAACGACGAGACTCGACGAAAGCACCTCCGTATTGGGAGAAGGGCTGGAGGACACAA AAACATCGACGGGCAGACATGACATGTGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1782663: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826633286585AI043328TENU0969T. cruzi epimastigote normalized cDNA Library


Date: 17:5:55 on Thu 23 Nov 117.