EST 1782668 is a singleton


Sequence

>1782668 (1 EST) Length=252 GGCACCTCAGACGCCGCAGCCACGGGAGGCAACTGTCGCTGCTCTTGTGGCGGCGGTGCCGTATGTTCACTGTCACAAAC CTCCTCCCCGTGATCCCGATCCGGCAAAAAACTCATCGGCAACAAACTTTTCCCCCAAATAAATCTCCACCCCTCGCCCC TCCCTCTACCGCCAGGACCGAGGCGTGTGTTTCACGCTTTCCACCCCTCGCAAAGCAAAACAAATCTTCACTGCACCTCC AGCTAGAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1782668: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826683286590AI043333TENU0974T. cruzi epimastigote normalized cDNA Library


Date: 6:42:54 on Tue 21 Nov 117.