EST 1782671 is a singleton


Sequence

>1782671 (1 EST) Length=298 GTTTTCGCTTCTCTTTCTCACTTCCCACTGCAAAAGGGCCCACATGCACAAGATTTGATTCATAGACACCCAAATACTGC CTAAAGAAAAGAGTTATCGTCAGTACGTATGCGCTTCATATGACTGGTGCCAAGCAACGGAAGCAAATGGGACATACCGG CTGCCTTTAGTGCAGACTTGATGTCGTGCGCCGAAAGAGTTACACGTTTCTTTCCCTCTCGAGACCTTTCATCCTCAGCA AGACATGACAGGTACAATAAAAACAGAGTAGCTGCCTTTTGAAAAGCGATACGAGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782671: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826713286593AI043336TENU0977T. cruzi epimastigote normalized cDNA Library


Date: 6:52:37 on Tue 21 Nov 117.