EST 1782674 is a singleton


Sequence

>1782674 (1 EST) Length=155 CCACAGGTTAGCAAAATTCCTAATTACTATTCTTAAAGGCTTCACTTTTTAGTGACCGGCAATCGCACAAGCAGCCGACA CAGAAACACAGACAGACAGACACACACACACACACGAAAAAAAACATGAAAAAGAAAAACAAGACATATTTCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1782674: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826743286596AI043339TENU0980T. cruzi epimastigote normalized cDNA Library


Date: 15:0:29 on Sun 19 Nov 117.