EST 1782675 is a singleton


Sequence

>1782675 (1 EST) Length=301 ATTACATAAAAGACGGGTCCAAGAGTCATTTTTGCCATCACACATCCCCCAACGCCCTCCAACCGAGTGAAATTTTCTTC TCAAAGTAAGATCCAACAGGCAACGACCTTTTCAACATGGCAGCCGTCGCCTCGTCCAGCAGCTCTGGTTCCACGCCAAT GAGGCGCCGGAGTGTTAGCTGTTTTTCCTCCTCCAGTGTGGGCTGCGGTTGGATGTAGCGCCCTTCATTAACAGCCGCGC CAGGCTTCTTGACTTCAATGCCCGTCACAAAAGGGAAAAACAGCAAATTCGATTCTCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782675: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826753286597AI043340TENU0981T. cruzi epimastigote normalized cDNA Library


Date: 19:37:47 on Mon 20 Nov 117.