EST 1782772 is a singleton


Sequence

>1782772 (1 EST) Length=317 AAAGGTATACGTGTGTAATGCATGCATGTGAGTTGACGTCTTTTACCCGCGACAACTCTGGTACTGAATGGACAATGTGA AGGAGGCGGTTCTCGACCGCAAGTTCCCTACGGCTGTGACGACTTCAAAGCTCCGCAATCGCGACATGACTCACGGTCCC TGAAATTCTTGTATCCGCACCCGCAAATCCACAGTGAGGGGTCAGTGGCACCGCTCGCTATCGCAGATAACGTTCCGCAA TTCTTGCAGCGTGCCCGTGAAGAAAAGTTAAGAAATCCACACTGATCACAGTGCCAGTCGTCACGCCGTGCAGACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1782772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17827723290219AI043436TENU0995T. cruzi epimastigote normalized cDNA Library


Date: 6:50:18 on Sat 25 Nov 117.