EST 1782775 is a singleton


Sequence

>1782775 (1 EST) Length=234 CATTTCCTTTCTTCAGTCTGGTTTAATGGTGTATTCCCGATGCGTACGCAACCGTCACCCCTGTACGTTGCCTTGGGGTT AATTGTTCAGTGGTATGTTATCCATAACATTATCATTATTGTTTTTCTCCGTTGGAGGAGGGGGAGGAGACACTCCGTCA TTTTTGTTTTCGGGTCTGTATTTTTTGAAGATACATAAAAGAAGCATTTACGCACGTGCACAAGGGATACTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782775: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17827753290222AI043439TENU0998T. cruzi epimastigote normalized cDNA Library


Date: 12:55:10 on Sat 18 Nov 117.