EST 1782777 is a singleton


Sequence

>1782777 (1 EST) Length=188 GAGATGTCGCATAGGTTGGCATCTACGTGTGCATACATGTATTCGTCTGACTTCATGACAAACCGGAGAACCCGTGCAGC TAACGGCCCGCACTACCGTTCGTTCCTCCCCTCCTTTATTCCATACAAATTACAACAACAACAACAACAAAAAATACACA CAGACACACAGAGAGGGATGAACGCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782777: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17827773290224AI043441TENU01000T. cruzi epimastigote normalized cDNA Library


Date: 2:23:56 on Mon 20 Nov 117.