EST 1782796 is a singleton


Sequence

>1782796 (1 EST) Length=405 GTGTGTTTGTTGCCACCATCCACCAGCGTCTTAAACAAAAAAAAAAAAAACCTTACTCACTGTCTTTCATAAGTGTCTCA ACACAAACACCCTTCCCAGACAGTTGCCTCACCTTTGCCTTGTGTTTACTGCTGTTTATGTGCTCATTGTATTGTCCAGC CTTCTTAAACTGTTTTTTGCAAGCAGGACAGTTAAGATTTGGCCCGCCGTTATCGTCTTCATTATCGCCCTCTAGCATTG CAAATCCGTCAGCATTACTGCCCTTGGATTTTCGCATCTTTTCCACTTGGCGTTGCTTTTCGTAGAGCAACTCCAATGTC TGGCCGTCCATGGTTGGNNCCTCTGTCGATTCGAGCCTGTTCTTCCTCTGCTTCCTTCTCGGCTGCAGCCAACCAAATTC TTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782796: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17827963290243AI043460TENU1019T. cruzi epimastigote normalized cDNA Library


Date: 1:49:30 on Sat 18 Nov 117.