EST 1782797 is a singleton


Sequence

>1782797 (1 EST) Length=165 CCCGTCATCACCACCAAAACCACCTCTCAAAGGGTCATTCGTTCTAATAGAGTAATTATCCCTACAGAGACATTCATTAC CCATGCTATCCCACAACTAAACTAAAGGGGCATATCATTTTCCCTAATCACTATGTTCTCTCAGTATTTTCCGTTTCTCT CTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1782797: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17827973290244AI043461TENU1020T. cruzi epimastigote normalized cDNA Library


Date: 11:55:35 on Wed 22 Nov 117.