EST 1782798 is a singleton


Sequence

>1782798 (1 EST) Length=510 CTCTTCACGGGGGCAATGTGTTAGATGCGGAACCACCCTGTGCAATAATTGTGCTGTCTGCAGCGATACGANGTCGAAGA TGTGTCTTGATTGTTACAAGCTTTGCGAATGGAATACACAGTAGCAATGGAGGATCCAAGTGTGCGCATCTGTGAGAAGG GAGAAAGCCCCCCATAAAACAAAAAAAAAAGAAAAAGAAAATAAGAGCCGCCTTTTGGTGTTGTTGTTTTGCGAGCGAGA TGAATGCGCACTAGCGACATAACGCGGGACCTCTTCTGGGAGCTTTGCTGCAATTCTCTCGGGTTAGAAATGCTTGCTTG AAGTTTTCCGCTATCTTGTTGATGTTGCTTCCTTTCTCTGGGACTCATGGTTTTTCTTTCCTGCATTGTTTTCACCTCCA TTTGGTGTGAATGCTGAAACGCGAGTCGCCCACATCGCGCAAAAGCAAAACACATTCTAAGGAATAGCATAGACATCGAA GAGCCGCCGCATTGGACACGCCAATCTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782798: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17827983290245AI043462TENU1021T. cruzi epimastigote normalized cDNA Library


Date: 17:20:23 on Wed 22 Nov 117.