EST 1782811 is a singleton


Sequence

>1782811 (1 EST) Length=439 GGGATCGCATAAAGGCAAAAATTAGCAAGGCGGGGTTGCACTCCAACTCCAAGTTTTGCCCTCCCCCTAATTTTTTATTC CTTTTCGCATAAAGAACAAACCAACATTTTTTCTTGTTTTTGTTGTTGTTGTTGTTTTGTTTTTGTTTTGTTTTGTTTTG TTTTTGGAAATAAAAAGTTATAGGTACTGTCTACATTCAAACTAGTTTCATCGTCATCGTTCTTTGTTGTTGTTTTGTTT GTTTGTTTGATCCTTTTCGCTGATGTCATTTCTTTTTCTTGTCTTCTACCACTGAGCCTCGTTAGAGTAGGAACGAGTAA AGAACCGACGTCCAAACGCATCGGGATTTTTCATGATGTCTTGCTGCTGCTTCTGCTGTTGTTGGCGTGCAGCTTCTGAA TTTCGAGGTATCTGCGATGAATAAATAGGAGGCATCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782811: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17828113290258AI043475TENU1035T. cruzi epimastigote normalized cDNA Library


Date: 6:19:26 on Thu 23 Nov 117.