EST 1782812 is a singleton


Sequence

>1782812 (1 EST) Length=376 CCACGGATCTTCTTACAATACGGAAGGAAGAATTACCCCATCCCACCACCATCACTACCACAGTTAGTAAGCACCTCGTC CCATTTTTCTTTTCGTTTAATTTTTCAACTCATTGCCTACTTTTTTTCCCCCTTTCCCATTCGTGTTGTTTGGTTCGGTT GGATCCTTTTCTTTCTTTACTCCTTCTTTTCGCCTGAAAGCTACATATCACTGTTTCGTTTTAATCAGCACAACACAACT GGCGGTTTTTTAAATGCTTTTCTTCCATTCTTCCCCTTCCCTGTACGCGTGATGCATACATAGATGCGTATGTAGGCGTT TTTCAGCGTACACTACCTCTGCCTTCAGTGCTTTCATTTAATTTTTGTTGTTGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1782812: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17828123290259AI043476TENU1036T. cruzi epimastigote normalized cDNA Library


Date: 0:40:40 on Thu 23 Nov 117.