EST 1782816 is a singleton


Sequence

>1782816 (1 EST) Length=298 GGAAACAACGGTAGGGTCATGATGGATGTGGTGCGGGTGCGGCGTCGGGGTTGCTGTTTTCCGTACGCTCCGCCCAGACG GCAGTTGGGTTAACGACGTACTTCACCCCCTTGCGTCTCTCCGTTACAACCCGACAAACGGCCTTCCCACAGACGGTACA ACAGCCCTCCAGGACAGTCGGGTCGCTTCGCTTATTCTCATCTCTTAGGCACTCCTCACGCCATGTACGATGCTGCAGCC TCACACAACGTCCACTACGCGTCNGCCGCAGCATGTCCCCCTCGACACGCAACCCGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1782816: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17828163290263AI043480TENU1040T. cruzi epimastigote normalized cDNA Library


Date: 14:20:0 on Sat 18 Nov 117.