EST 1782833 is a singleton


Sequence

>1782833 (1 EST) Length=163 AACATCAATTGGAACAGCACACGTCACGCTCAGACTCAAACACCGGTTTTCAAATAGGAAGTAAATAAATCAAGTACATA TGCGGATTGCNTGGGCACCGGAAAACGCAAAAAATTGCGCTGCGGAATTAAGACCATGAAACACTTACAAAAAAAAAAAG AAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1782833: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17828333290280AI043497TENU1057T. cruzi epimastigote normalized cDNA Library


Date: 17:35:58 on Mon 20 Nov 117.