EST 1785373 is a singleton


Sequence

>1785373 (1 EST) Length=148 TCCCCCCGGCCGTCTCAGCGTGCTACGCCAGGGCCAATTGCCCCATCTTGTCGGGAGANACAGTTCTAACGCCATGAAGC CTAGTGACACGTCATACCGTCATGCGAGCCCTCAAATATGTTCGGGCAAACAAATATATATAAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785373: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17853733293879AI046246TENU1115T. cruzi epimastigote normalized cDNA Library


Date: 23:53:23 on Fri 17 Nov 117.