EST 1785382 is a singleton


Sequence

>1785382 (1 EST) Length=236 ATGCAATCCACCCTGCTCTTTTTTTTTTTTTTTTTTTTTTTCATGCGTCCGGNGTGCCTGTGCACCAATTCTCTCCCTCC CGCTGTATATATGTATGTATCTGTGTGTAGATATCCCCCTTTCCTTCCTCCCTTTTGCCTCTTTTATTATAAAAATGTTA TGGCCGTTGTTTGTTCTCTTCTTCTTCTTCTCACTTCACGCCCCTCCCCACCTCCCAGAGGCAGAGATACAGACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1785382: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17853823293888AI046255TENU1125T. cruzi epimastigote normalized cDNA Library


Date: 17:12:31 on Thu 23 Nov 117.