EST 1785384 is a singleton


Sequence

>1785384 (1 EST) Length=223 CCCCCCCATTGTGGCTCTTCAACGGCCATCCATTCGTTGTTTTGCTCCCCTACCACCGCCTGCACGCCCTCTTCAGCCAA GAGCGAACCGCCCCACGTTTTTTTGTTGCGGATCGTTCCCTTCGCTTTTTTGTCTCACCCCTCCTCCCCCTCTTTTATTA TTATTTTTANTTTTGCTGGAAAGAAGGAGGAGGAGAAAAGGGTTCCATTCACGTATGCCCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1785384: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17853843293890AI046257TENU1127T. cruzi epimastigote normalized cDNA Library


Date: 21:23:58 on Sun 19 Nov 117.